Skip to main content
Download PDF

Exploring New Delhi Metallo Beta Lactamases in Klebsiella pneumoniae and Escherichia coli: genotypic vs. phenotypic insights

Annals of Clinical Microbiology and Antimicrobials volume 24, Article number: 12 (2025) Cite this article

Abstract

Background

Carbapenemase-producing Enterobacterales pose a serious clinical threat, particularly in high-burden settings of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae (CREK), where rapid detection tools are essential to aid patient management. In this study, we focused on blaNDM, the most frequently reported carbapenemase in the region, and evaluated a combined phenotypic (lateral flow) and genotypic (PCR and WGS) approach for its detection. This research underscores the utility of lateral flow assays as a practical alternative to resource-intensive genotypic methods, offering a scalable solution for settings with limited laboratory capacity.

Method

One hundred seventy-seven extensively drug-resistant strains were characterized using MALDI-TOF. Isolates were analyzed to detect Carbapenem-resistant Escherichia coli and Klebsiella pneumoniae (CREK) using disk diffusion, MIC test, and PCR targeting blaNDM. Antibiotic susceptibility patterns were analyzed and visualized using single-linkage hierarchical clustering, with results displayed on a permuted heat map. Immunochromatographic assay, RESIST-5 O.K.N.V.I (Coris Bioconcept®) was used for CREK isolates [(n = 17), positive and negative)] and Oxford Nanopore Sequencing was conducted on subsets [(n = 5) blaNDM-positive co-producers of blaNDM and blaOXA, and (n = 2) blaNDM-negative blaOXA producers) to evaluate the reliability of phenotypic and genotypic tests.

Result

Most of the XDR strains (90%) were CREK, with K. pneumoniae (71.2%) more prevalent than E. coli (28.7%) (p < 0.05). All CREK strains exhibited complete resistance (100%) to multiple antibiotics with 66% showing sensitivity to levofloxacin. Furthermore, K. pneumoniae (57.8%) had higher blaNDM gene prevalence than E. coli (36.9%). Among blaNDM-positive CREK, lateral flow assay revealed approximately half of each bacteria type co-produced blaOXA (E.coli, 52.9%), and (K. pneumoniae, 47%). For blaNDM-negative strains, blaOXA was more prevalent in K. pneumoniae (82.35%) than E. coli (41%) (p < 0.05). Comparing phenotypic to genotypic assays, E. coli showed 100% (CI 80.49 − 100%) sensitivity and specificity with a high Kappa agreement coefficient (0.91) (CI 95% 0.661–1, p < 0.01), whereas K. pneumoniae assays had lower sensitivity and specificity (40%) (CI 5.27 − 85.34%), with a lower Kappa agreement coefficient (0.20) (CI 95% 0.104–0.298, p < 0.01).

Conclusion

This study demonstrates the value of the RESIST-5 O.K.N.V.I. lateral flow assay as a rapid and reliable diagnostic tool for detecting blaNDM in Escherichia coli, with strong agreement to PCR and WGS. While performance for Klebsiella pneumoniae was lower, the assay offers a practical alternative in resource-limited settings, aiding antimicrobial stewardship and improving diagnostic capacities in high-burden regions.

Introduction

Carbapenem-resistant E. coli and Klebsiella (CREK) isolates are found worldwide, primarily due to transmission of carbapenemase-encoding genes conferring resistance to carbapenem drugs [1,2,3]. CREK present substantial clinical and public health concerns as they can spread within healthcare settings and the community [3,4,5]. This dissemination is alarming due to the limited treatment options available and the associated increase in mortality rates [6, 7].

K. pneumoniae and E.coli are major reservoir for carbapenemases. Five primary carbapenemase-associated genes of concern among CREK are blaOXA−48, blaKPC, blaVIM, blaIMP and blaNDM, whose prevalence and distribution differ by geographic region [8, 9]. Compared to USA China and Europe were KPC enzymes are the frequently reported among CREK, the literature reports blaOXA and blaNDM gene variants to be the most prevalent among CREK in Pakistan [3, 10]. According to a meta-analysis, blaNDM was identified as the most prevalent carbapenemase in 5 out of 9 studies [11], with a recent report indicating its incidence among carbapenem-resistant isolates to be 53.25% [12]. The spread of New Delhi Metallo Beta Lactamases (NDM) is critical to manage, particularly in Pakistan, given its proximity to India, which is considered an epicenter for the emergence and spread of blaNDM [13, 14].

Identifying carbapenemase-producing CREK is critical in the clinical microbiology laboratory [15,16,17,18]. This identification holds significant implications for infection control, the selection of appropriate therapy, of establishing surveillance protocols within the hospital setting [19]. Clinical laboratories may employ several diagnostic tools, phenotypic approaches include culture-based techniques, immuno-chromatographic assays (lateral flow kits, ) and genotypic methods use gene amplification [20]. These tools enable accurate detection and characterization of CREK, supporting effective management of infections and implementation of control measures in healthcare settings [21,22,23].

In resource-deficient settings such as lower middle-income countries (LMICs), culture-based assays are preferred due to cost constraints [24,25,26]. However, their extended turnaround times for diagnosis make them less suitable for efficient and timely reporting of results than molecular or genotypic methods [27, 28]. However, these methods require specialized expertise and equipment, yet they offer the advantage of being faster and more accurate [18]. Additionally, whole genome sequencing (WGS) delivers detailed insights into the underlying resistome and virulome mechanisms, which can be effective for controlling the dissemination of carbapenem-resistant (CR) and ensuring accurate diagnosis of CREK pathogens [29, 30]. However, its implementation is hindered by the need for expensive equipment and specialized expertise, posing challenges in resource-limited settings, particularly in developing countries [31,32,33].

Keeping in view the urgency of the issue and making possible the timely treatment of patients suffering from deadly infections, various Lateral flow kits, such as the RESIST-5 O.K.N.V.I used here, are available commercially, which provide rapid detection and characterization of the carbapenemase-resistant organisms with good sensitivity (99.4–100%) and specificity (100%) [34,35,36,37]. Nevertheless, there is a risk of cross-reactivity associated with such assays, primarily due to reliance on antigen-antibody interactions, especially when dealing with isolates containing blaOXA, although there have been no reported instances for blaNDM [38]. Therefore, accurate results from these assays are important for effective management of the infection, prevention and dissemination of CREK.

Our objective was to evaluate the effectiveness of the RESIST-5 O.K.N.V.I (CORIS Bio Concept, Gembloux, Belgium) lateral flow immunochromatographic assay kit in conjunction with PCR and WGS for identification of carbapenemases, with a specific emphasis on detecting blaNDM types within CREK strains.

Material and methods study design

This seven-year study (2015–2021) was conducted in two main phases. Initially, at the Institute of Microbiology and Molecular Genetics, University of the Punjab, Lahore, Pakistan and CitiLab and Research Center, Lahore Pakistan where samples underwent preliminary identification and molecular screening for CR. Subsequently, advanced genomic studies, including Oxford Nanopore sequencing, were carried out at the Center of Clinical Microbiology, University College London.

The bacterial isolates were collected from three major government hospitals and one referral diagnostic center. The bacterial isolates were collected after the ethical approval and consent. The hospitals’ primary catchment area is Lahore, which has a population of 6.7 million in the Punjab province of Pakistan. The study employed a comparative design to assess the phenotypic-genotypic detection of the carbapenemase gene, specifically blaNDM, in extensive drug-resistant (XDR) CREK [10].

Bacterial strains

To determine the prevalence of E. coli and K. pneumoniae among clinical XDR, specimens from patients (n = 177) were streaked onto selective agar plates, specifically MacConkey agar and Blood Agar (Oxoid, Basingstoke Hampshire, UK). These agar plates were incubated aerobically at 37°C for 24 h.

All suspected E. coli and K. pneumoniae isolates from these plates underwent Gram staining (ThermoFisher Scientific, Heysham, UK), were tested for oxidase (Oxoid, Basingstoke, Hampshire, UK), and subjected to the API 20E system (bioMerieux, Marcy L’Etoile, France) for preliminary identification of E. coli and K. pneumoniae. Further confirmation was conducted using a MALDI-TOF (MALDI Biotyper, Bruker Daltonics, Billerica, USA) [39, 40].

Antibiogram assay

To assess the antibiotic susceptibility pattern, all isolates were subjected to antibiotic sensitivity testing (AST) using the Kirby-Bauer method on Mueller-Hinton agar (Oxoid, Basingstoke, Hampshire, UK) plates following the Clinical Laboratory Standards Institute (CLSI) recommendations 2017–2019 [41, 42]. The antibiotic panel used for E. coli and K. pneumoniae included; penicillin’s and combinations (amoxicillin 30 μg, amoxicillin-clavulanic acid 40 μg, cefoperazone/Sulbactam 40 μg and piperacillin-tazobactam 30 μg), monobactam (aztreonam 30 μg), extended-spectrum cephalosporins (ceftriaxone 30 μg, cefepime 30 μg, cefotaxime 30 μg, cefoxitin 30 μg, and ceftazidime 30 μg), carbapenems (imipenem 10 μg, meropenem 10 μg), aminoglycosides (amikacin 30 μg and gentamicin 30 μg), a quinolone (ciprofloxacin 30 μg, moxifloxacin 30 μg), folate pathway inhibitors (trimethoprim/ Sulphametoxazole). All antibiotic discs were obtained from Oxoid (Basingstoke, Hampshire, UK).

Minimum inhibitory concentration (MICs)

Furthermore, to enhance our understanding of the antimicrobial susceptibility profiles of CREK bacterial strains, we perform a minimum inhibitory concentration (MIC) assay using the agar dilution method for key antimicrobial agents, i.e., imipenem, meropenem, doxycycline, gentamycin, colistin and tigecycline (Oxoid, Basingstoke, Hampshire, UK). The assay was performed using the Mueller Hinton agar plates (Oxoid, Basingstoke, Hampshire, UK) diluted with the appropriate concentration of antibiotics and spotting the prepared inoculum of the bacterial isolates following the already described protocol [43]. The MIC was calculated according to the breakpoints provided by CLSI guidelines.

Detection of New Delhi Metallo Beta Lactamases (bla NDM) gene

To assess the prevalence of the carbapenemase-encoding gene (blaNDM) among CREK, the isolates were further examined for the presence of the blaNDM gene using singleplex PCR. The DNA template used for the PCR was extracted using previously described methods [44]. The PCR reaction was set up with a 25 μL mixture containing 10X PCR buffer, 2.5 mM dNTPs, 20 pmol each primer and 2.5 U of Taq polymerase (Invitrogen, Carlsbad, California, USA). The PCR conditions were set with an initial denaturation at 95 °C. This was followed by 35 cycles of 1 min (min) denaturation at 95 °C, 1.5 min annealing at 53ºC, extension for 1 min and final extension for 10 min at 72 °C. The Mg concentration was maintained between 1 and 1.5 mM. The set of primers (F5’ATGGAATTGCCCAATATTATG3’, R5’TCAGCGCAGCTTGTCGGCC3’) was used to amplify the full-length amplicon of blaNDM gene [45]. Furthermore, positive controls for blaNDM detection in K. pneumoniae (ATCC BAA1705) and E. coli (ATCC BAA2452) were included.

Lateral flow assay

To detect carbapenemase genes other than blaNDM, we selected blaNDM-positive (n = 17) and blaNDM-negative (n = 17) isolates from E. coli and K. pneumoniae strains. These isolates were then tested using the RESIST-5 immunochromatographic lateral flow assay kit with two cassettes (CORIS Bio Concept, Gembloux, Belgium), following the manufacturer’s instructions.

The first cassette detects blaVIM and blaIMP, while the second targets blaOXA−48-like variants, blaKPC, and blaNDM, enabling the identification of five major carbapenemase encoding genes. These cassettes feature nitrocellulose membranes sensitised with monoclonal antibodies and employ colloidal gold nanoparticles to target or detect blaVIM, blaIMP, blaKPC, blaNDM and blaOXA−48-like variants.

Whole genome sequencing (WGS)

To accurately identify blaNDM and blaOXA encoding carbapenemase genes and to compare the phenotypic with genotypic detection of blaNDM among CREK strains. We conducted high throughput Oxford Nanopore sequencing on subsets of selected CREK strains: those positive for blaNDM (n = 5), co-producers of blaNDM and blaOXA (n = 5), those negative for blaNDM and blaOXA (n = 2), and producers of blaOXA XA without blaNDM (n = 2).

A DNA library was prepared using the ONT Rapid Barcoding 96 Kit (SQK-RBK110.96) (Oxford NANOPORE technologies, Oxford, UK), following the manufacturer’s guidelines [46]. Twenty barcoded isolates were run on an R9.4.1 flow cell (ONT) using the Mk1B device for 48 h, using the default parameters of MinKNOW (v21.11.7) software. Base calling was performed using Guppy (v6.0.6) and the flip-flop fast algorithm.

Resistome analysis and plasmid profiling

The drug resistance genes (resistome) were investigated using the Comprehensive Antibiotic Resistance Database (CARD, version 4.0, ( https://card.mcmaster.ca/analyze ). Briefly, the whole-genome sequence of each isolate was analyzed using the Resistance Gene Identifier (RGI, version 5.2.0) in the Comprehensive Antibiotic Resistance Database (CARD). We employed the parameters ‘Perfect and strict hits only’, ‘Include nudge’ and ‘high-quality coverage’, to predict the antimicrobial resistance genes (ARGs) [47].

Furthermore, plasmid replicon types were determined using Plasmid Finder, version 2.1 of the Center for Genomic Epidemiology (CGE) ( http://www.genomicepidemiology.org ) [48].

Statistical analysis

Statistical computations were performed using SPSS (IBM Corp. IBM SPSS Statistics for Windows, Version 23.0. Armonk, NY: IBM Corp.). The demographic distribution across age, gender, department, and specimens was evaluated using the Chi-squared test and one-way ANOVA. Post-hoc pairwise comparisons between groups were conducted through Tukey’s multiple-comparison test, with significance at p < 0.05. The distribution frequency of the blaNDM gene was calculated as a percentage and subjected to Student t-tests, where statistical significance was defined as p < 0.05.

In addition, an analysis of antibiotic susceptibility patterns involved clustering with proximity enhancement, followed by the display of permuted data in a heat map. A hierarchical clustering heat map of antibiotic resistance profiles for isolates was generated using XLSTAT (Addinsoft, New York, USA).

Furthermore, measures of central tendency were computed, and the detection capacity was assessed using the Kappa coefficient between genotypic methods (PCR and WGS) and phenotypic assays (lateral flow). Comparable agreements closer to 1 were considered, and statistical significance was set at p < 0.05. Sensitivity %, specificity %, negative predictive (NPV), and positive predictive values (PPV) were calculated for phenotypic and genotypic assays in detecting blaNDM gene among CREK.

Results

Isolation, identification, antibiotic susceptibility pattern and minimum inhibitory concentrations of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae from clinical specimens

Of the 177 XDR isolates, 90.3% (160/177) were confirmed CREK. Within this group, K. pneumoniae represented 71.2% (114/160) of the isolates, demonstrating a significantly higher prevalence of carbapenem resistance compared to E. coli, which accounted for 28.7% (46/160) of the isolates (p < 0.05). Notably, the demographic analysis shows that the majority of K. pneumoniae isolates were obtained from urine samples (33.3%, n = 38/114) followed by blood specimens (13.1%, n = 15/114) among in-patients (p < 0.05). Similar patterns were observed for E. coli (urine, 41.3%, n = 19/46 and blood, 10.8%, n = 15/46) (Table 1). Moreover, the disk diffusion method was used to determine the antibiotic susceptibility and similarity pattern between CREK isolates, and antibiotic resistance profiles were analyzed through hierarchical clustering. The CREK isolates exhibited complete resistance to several antibiotics, including ampicillin (100%), Cefoparazone (100%), Ceftriaxone (100%), Cefepime (100%), aztreonam (100%), tetracycline (100%) and augmented (100%). Conversely, the antibiotics with the greatest number of sensitive CREK isolates were tigecycline (23.9% E. coli and 6.1% in K. pneumoniae) and levofloxacin (66% E.coli and 65% in K. pneumoniae) (Fig. 1). Hierarchical clustering revealed three primary clusters: A, B, and C. Cluster A grouped four CREK isolates, consisting of two from E. coli (E128 and E144) and two from K. pneumoniae (K76 and K92). K76 and K92 demonstrated the highest antibiotic susceptibility similarities within cluster A. Cluster B encompassed one hundred and forty-six CREK isolates from E. coli (E115 to E122, E124 to E127, E133, E135 to E143, E145 to E153, and E155 to E166) and K. pneumoniae (K1 to K5, K8 to K10, K12 to K75, K77 to K91, and K93 to K114). Amongst the E. coli isolates in cluster B, there was a notable absence of variation in antibiotic susceptibility similarity. Conversely, K. pneumoniae isolates (K3 and K4) and (K35 and K54) displayed no similar antibiotic susceptibility within the same cluster. Additionally, cluster C comprised ten CREK isolates, including seven from E. coli (E123, E129 to E132, E134, and E154) and three from K. pneumoniae (K6, K7, and K11). All these isolates exhibited the highest similarity in antibiotic susceptibility patterns within cluster C (Fig. 2). Overall, we found that CREK isolates demonstrated high rates of sensitivity to colistin, 82.6% for E. coli and 87.7% for K. pneumoniae, while there were notable rates of sensitivity to tigecycline, 65.2% for E. coli and 68.4% for K. pneumoniae(p < 0.05). Conversely, the highest rates of resistance were found to be against imipenem (80.7%) and meropenem (100%), characterized by higher breakpoint values (≥ 16 μg/ml), particularly among K. pneumoniae, in comparison to E. coli (imipenem 76%, meropenem 100% at 16 μg/ml).

Fig. 1
figure 1

Antibiotic susceptibility profiling of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae (CREK) isolates. Recommended panel of antibiotics was tested against the CREK isolates to access the overall resistant pattern against the used antibiotics. Results have been presented in the radar graph in terms of percentage calculated as (number of resistant isolates to respective antibiotic / total no of isolates \(\:\times\:\) 100)

Full size image
Fig. 2
figure 2

Heatmap showing hierarchical clustering of isolates antibiotic resistance profiles. Antibiotic susceptibility and similarity pattern between CREK bacterial strains were examined through single linkage clustering, and a heat map was generated using XLSTAT. The antimicrobial resistance profiles are placed horizontally, and CREK strains vertically and phylogenies construct accordingly. Key: CREK, carbapenem-resistant E. coli and K. pneumoniae

Full size image
Table 1 Demographic attributes of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae (CREK) isolated from both in-patients and out-patients
Full size table

Notably, our findings indicated higher rates of resistance to colistin among E. coli (13%) compared to K. pneumoniae (9.6%), with a similar trend observed for tigecycline, where resistance rates were higher in E. coli (28.2%) compared to K. pneumoniae (14%) (p < 0.05) (Table 2).

Table 2 Minimum inhibitory concentrations (MIC)
Full size table

Distribution frequency of new Delhi Metallo beta-lactamases (blaNDM) gene among carbapenem-resistant Escherichia coli and Klebsiella pneumoniae using singleplex PCR

The amplified blaNDM gene, yielding a product size of 931 bp was identified in the positive isolates (Supplementary Fig. 1). We found a higher prevalence of blaNDM gene occurrence among K. pneumoniae, 57.8% (n = 66/114), when compared to E. coli, 36.9% (n = 17/46) (p < 0.05). However, these genotypic results did not agree with the results of phenotypic detection of carbapenem resistance among CREK.

Distribution of carbapenemase genes among carbapenem-resistant Escherichia coli and Klebsiella pneumoniae using lateral flow assay

We observed a 100% (n = 17/17) detection rate of blaNDM-encoded carbapenemase production among CREK bacterial strains. The test demonstrated a sensitivity and specificity of 100% (CI 80.49 − 100%). The negative predictive value (NPV) and the positive predictive value (PPV) were 100% (CI 80.49 − 100%). Moreover, the outcomes of lateral flow assays revealed that 52.9% (n = 9/17) of E. coli strains exhibited co-production of blaOXA, while 47% (n = 8/17) of K. pneumoniae strains were identified as coproducers of blaOXA(p < 0.05). Furthermore, we found a higher 82.35% (n = 14/17) blaOXA incidence among blaNDM-negative K. pneumoniae in comparison to E. coli isolates 41% (n = 7/17) (p < 0.05) (Table 3).

Table 3 Distribution patterns of carbapenemase genes were identified using lateral flow assay and precision evaluation of phenotypic test (lateral flow) compared to PCR
Full size table

Comparative analysis of phenotypic and genotypic methods for identifying carbapenemase genes in carbapenem-resistant Escherichia coli and Klebsiella pneumoniae

WGS analysis revealed a comparable variant of blaNDM, specifically blaNDM−5, encoding carbapenemase within CREK. (p < 0.05). In contrast, the predominant blaOXA variants among E. coli were blaOXA−1 and blaOXA−181, while K. pneumoniae bacterial strains predominantly carry blaOXA−232(p < 0.05). Furthermore, the results for the subset of strains (positive for blaNDM, co-producers of blaNDM and blaOXA, those negative for both blaNDM and blaOXA, and those with blaOXA without blaNDM) were compared across lateral flow, PCR and NGS methods. For the blaNDM-positive subset, Escherichia coli demonstrated a sensitivity and specificity of 100% (95% CI: 80.49 − 100%), with a Kappa coefficient of 0.91 (95% CI: 0.661–1.0, p < 0.01). The PPV and NPV were also 100% (95% CI: 80.49 − 100%). Conversely, for Klebsiella pneumoniae strains, sensitivity and specificity were 40% (95% CI: 5.27 − 85.34%), with both PPV and NPV at 40% (95% CI: 15.50 − 70.78%). The Kappa coefficient for K. pneumoniae was 0.20 (95% CI: 0.104–0.298, p < 0.01). Conversely, for strains co-producing blaNDM and blaOXA, as well as those negative for both blaNDM and blaOXA, and those with blaOXA without blaNDM, we found a sensitivity and specificity of 100% (CI 80.49 − 100%), with PPV and NPV both at 100% (CI 80.49 − 100%) (Table 4). Moreover, the analysis through WGS indicated the absence of blaKPC, blaVIM, and blaIMP within CREK isolates.

Table 4 Comparative analysis of phenotypic vs. genotypic methods in carbapenemase gene identification - overall performance Metrics
Full size table

Resistome analysis and plasmid profiling of bla NDMand bla OXAcarrying Escherichia coli and Klebsiella pneumoniae bacterial isolates

Across all the WGS-tested isolates, the CARD analysis revealed 370 gene variants conferring resistance to 16 distinct classes of antibiotics. The beta-lactam drug class had the highest diversity of resistant genes (n = 67), followed by fluoroquinolones (n = 64). The most prevalent beta-lactam drug resistance gene variants were blaampH, blaCTX−M−15, blaOXA−1, and blaNDM−5 (Fig. 3). Furthermore, IncFIB was the most prevalent plasmid among CREK (Fig. 4).

Fig. 3
figure 3

Antibiotic resistance gene profiling. The antibiotic resistance genes (ARGs) in carbapenem-resistant K. pneumoniae(A) and E. coli(B) (CREK) isolates carrying blaNDM and blaOXA were identified by aligning their whole-genome sequences with the Comprehensive Antibiotic Resistance Database (CARD). Dark blue blocks represent ARGs exhibiting 70% identity. Further, ARGs were categorized based on their functions, and the respective categories are presented alongside the gene name

Full size image
Fig. 4
figure 4

Plasmid maps profiling of blaNDM, Plasmids were generated using nanopore sequencing data. The dark green colored blocks present the plasmids for E. coli and dark orange coloured blocks present plasmids for K. pneumoniae.

Full size image

Discussion

The study was designed to investigate the accuracy and efficiency of the lateral flow kits for detecting carbapenem resistance. Among the XDR isolates included in the study, the highest frequencies of CR were observed for K. pneumoniae, which agrees with the literature where XDR and pan-drug resistant (PDR) K. pneumoniae cases have been reported around the globe [49,50,51]. Notably, the lowest resistance rates were observed for colistin and tigecycline, reaffirming their role as last-line treatment options, similar to the reports published worldwide, which suggest them to be the only therapeutic choice to treat infections caused by XDRs [52, 53].

The results of the present study indicate a high incidence of CREK associated with urinary tract infections (UTIs), which is comparable with other studies [54, 55]. These findings imply that CREK could potentially play a role in causing UTIs among hospitalized patients. However the findings contrasts with a surveillance data from the region, where pus specimens were reported as the most common source of CREK isolates [56].

New Delhi Metallo-beta-lactamase (NDM) is the most prevalent carbapenemase in Pakistan and the broader South Asian subcontinent, reflecting a significant regional challenge in combating antimicrobial resistance [57,58,59]. In alignment with these trends, our study identified NDM as the dominant carbapenemase among the isolates, followed by OXA, VIM, and IMP, with KPC being the least frequently observed resistance mechanism [8]. These findings highlight the utility of targeted diagnostic approaches in this context. Specifically, lateral flow assays, such as RESIST-4 OKNV or RESIST-3 OKN, could serve as cost-effective alternatives for detecting carbapenemase activity in clinical settings. The implementation of these streamlined assays has the potential to significantly improve diagnostic accessibility and cost-effectiveness, particularly in resource-limited settings, while maintaining a high standard of diagnostic accuracy.

However, when evaluating blaNDM detection using statistical tests, the sensitivity and specificity of the studied lateral flow kits were 100% for E. coli compared to PCR, which was considered the gold standard for gene detection. These results coincide with other studies using the CORIS Bio Concept, Gembloux, Belgium kits [60,61,62,63]. While K. pneumoniae showed a lower sensitivity of 40%, indicating that the kits may have failed to identify NDM-producing strains despite PCR confirmation of the presence of blaNDM gene. The discrepancies in the results could have been because of the late expression or the drug-induced expression of the blaNDM gene [61, 64]. However, these findings need further investigation and present the study’s limitations.

Additionally, the resistome analysis indicated that beta-lactam genes were the most prevalent among all CREK, which coincides with the results of the antibiotic susceptibility testing presenting high resistance against beta-lactams. Interestingly, colistin resistance was observed in CREK isolates even without a mobile colistin resistance (mcr) gene, which is typically responsible for encoding colistin resistance and was not identified during CARD analysis [65]. These results suggest the possible acquisition of acquired resistance to colistin. As reported by early studies, lipopolysaccharide (LPS) modification may develop colistin resistance [66, 67]. The chromosomal genes phoPQ, pmrAB, and mgrB were the reported cause of colistin resistance until the first report of the mcr genes [68, 69]. None of these genes were found during the CARD analysis, these findings indicate that isolates with phenotypic colistin resistance must be subjected to further testing to identify the underlying mechanisms of colistin resistance.

The study reveals that the lateral flow assays tested for detecting blaNDM genes, which are responsible for carbapenemase production, show promise as a reliable and rapid diagnostic tool for E. coli bacterial strains. This advancement has the potential to significantly enhance clinical diagnostics and patient outcomes by enabling timely and accurate detection of carbapenem-resistant blaNDM-encoding E. coli infections.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Gupta V, et al. Detection of various beta-lactamases in Escherichia coli and Klebsiella sp.: a study from Tertiary Care Centre of North India. Ind J Med Microbiol. 2020;38(3–4):390–6.

    Article  Google Scholar 

  2. Hu H, et al. Prevalence and molecular characteristics of colistin-resistant isolates among clinically isolated carbapenem-resistant Klebsiella pneumoniae in China. Int J Antimicrob Agents. 2023;62(2):106873.

    Article  CAS  PubMed  Google Scholar 

  3. Habib A, et al. Dissemination of carbapenemase-producing enterobacterales in the community of Rawalpindi, Pakistan. PLoS ONE. 2022;17(7):e0270707.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Tang H-J, et al. Clinical significance of community-and healthcare-acquired carbapenem-resistant Enterobacteriaceae isolates. PLoS ONE. 2016;11(3):e0151897.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Bonomo RA, et al. Carbapenemase-producing organisms: a global scourge. Clin Infect Dis. 2018;66(8):1290–7.

    Article  CAS  PubMed  Google Scholar 

  7. Logan LK, Weinstein RA. The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis. 2017;215(suppl1):S28–36.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. ul Ain N, et al. Systematic surveillance and meta-analysis on the prevalence of metallo-β-lactamase producers among carbapenem resistant clinical isolates in Pakistan. J Global Antimicrob Resist. 2020;23:55–63.

    Article  Google Scholar 

  9. Gondal AJ et al. Novel carbapenem-resistant klebsiella pneumoniae ST147 coharboring bla NDM-1, bla OXA-48 and extended-spectrum β-lactamases from Pakistan. Infect Drug Resist. 2020:2105–15.

  10. Braun SD, et al. Prevalence of carbapenemase-producing organisms at the Kidney Center of Rawalpindi (Pakistan) and evaluation of an advanced molecular microarray-based carbapenemase assay. Future Microbiol. 2018;13(11):1225–46.

    Article  CAS  PubMed  Google Scholar 

  11. Ain NU, et al. Systematic surveillance and meta-analysis on the prevalence of metallo-β-lactamase producers among carbapenem resistant clinical isolates in Pakistan. J Global Antimicrob Resist. 2020;23:55–63.

    Article  Google Scholar 

  12. Ain NU et al. New Delhi metallo-β-lactamases among extensively drug-resistant clinical isolates from Lahore, Pakistan. Future microbiology. 2024:1–11.

  13. De Angelis G, et al. Molecular mechanisms, epidemiology, and clinical importance of β-lactam resistance in Enterobacteriaceae. Int J Mol Sci. 2020;21(14):5090.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Zarfel G, et al. Emergence of New Delhi metallo-β-lactamase, Austria. Emerg Infect Dis. 2011;17(1):129.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Rangel K, De-Simone S. Acinetobacter baumannii-the rise of a resistant pathogen: the rise of a resistant pathogen. BoD–Books on Demand; 2024.

  16. Zhang Z, et al. Comparison of the performance of phenotypic methods for the detection of Carbapenem-Resistant Enterobacteriaceae (CRE) in clinical practice. Front Cell Infect Microbiol. 2022;12:849564.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Yoon J, et al. Application of a multiplex immunochromatographic assay for rapid identification of carbapenemases in a clinical microbiology laboratory: performance and turn-around-time evaluation of NG-test carba 5. BMC Microbiol. 2021;21:1–7.

    Article  CAS  Google Scholar 

  18. Banerjee R, Humphries R. Clinical and laboratory considerations for the rapid detection of carbapenem-resistant Enterobacteriaceae. Virulence. 2017;8(4):427–39.

    Article  CAS  PubMed  Google Scholar 

  19. Zhu J, et al. Successful control of the first carbapenem-resistant Klebsiella pneumoniae outbreak in a Chinese hospital 2017–2019. Volume 9. Antimicrobial Resistance & Infection Control; 2020. pp. 1–9.

  20. Organization WH. Landscape of diagnostics against antibacterial resistance, gaps and priorities. 2019.

  21. Caliskan-Aydogan O, Alocilja EC. A review of carbapenem resistance in Enterobacterales and its detection techniques. Microorganisms. 2023;11(6):1491.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Alotaibi OFT. The molecular evaluation of New Rapid NG-Test for detection of Carbapenem Resistance Enterobactriaceae species isolated from King Abdulaziz University Hospital. KING ABDULAZIZ UNIVERSITY; 2023.

  23. Friedman ND, et al. Carbapenem-resistant Enterobacteriaceae: a strategic roadmap for infection control. Infect Control Hosp Epidemiol. 2017;38(5):580–94.

    Article  PubMed  Google Scholar 

  24. Byndoor Y, Sagar TV, Das A. Knowledge, attitude and awareness of pharmacovigilance among medical students in a tertiary care centre. Res J Pharm Technol. 2022;15(8):3759–63.

    Article  Google Scholar 

  25. Govindaswamy A, et al. Prevalence and characterization of beta-lactamase-producing Escherichia coli isolates from a tertiary care hospital in India. J Lab Physicians. 2019;11(02):123–7.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Mitgang EA, et al. Review and mapping of carbapenem-resistant Enterobacteriaceae in Africa: using diverse data to inform surveillance gaps. Int J Antimicrob Agents. 2018;52(3):372–84.

    Article  CAS  PubMed  Google Scholar 

  27. Arvidsson G et al. Multi-modal single cell sequencing of B cells in primary Sjögren’s syndrome. 2023.

  28. Rabaan AA, et al. An overview on phenotypic and genotypic characterisation of carbapenem-resistant enterobacterales. Medicina. 2022;58(11):1675.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Gentile B, et al. A retrospective whole-genome sequencing analysis of carbapenem and colistin-resistant Klebsiella pneumoniae nosocomial strains isolated during an MDR surveillance program. Antibiotics. 2020;9(5):246.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Cirkovic I, et al. Whole-genome sequencing snapshot of clinically relevant Carbapenem-Resistant Gram-negative Bacteria from Wastewater in Serbia. Antibiotics. 2023;12(2):350.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. AMR NG. H.R.U.o.G.S.o., whole-genome sequencing as part of national and international surveillance programmes for antimicrobial resistance: a roadmap. BMJ Global Health. 2020;5(11):e002244.

    Article  Google Scholar 

  32. Bianconi I, Aschbacher R, Pagani E. Current uses and future perspectives of genomic technologies in clinical microbiology. Antibiotics. 2023;12(11):1580.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Shanmugakani RK, et al. Current state of the art in rapid diagnostics for antimicrobial resistance. Lab Chip. 2020;20(15):2607–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Josa M. Comparative evaluation of phenotypic synergy tests versus RESIST-4 OKNV and NG Test Carba 5 lateral flow immunoassays for the detection and differentiation of carbapenemases in Enterobacterales and Pseudomonas aeruginosa. Microbiol Spectr. 2022;10(1):e01080–21.

    Article  Google Scholar 

  35. Han R, et al. Evaluation of the immunochromatographic NG-Test Carba 5, RESIST-5 OOKNV, and IMP K-SeT for rapid detection of KPC-, NDM-, IMP-, VIM-type, and OXA-48-like carbapenemase among Enterobacterales. Front Microbiol. 2021;11:609856.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Bianco G, et al. RESIST-5 OOKNV and NG-Test Carba 5 assays for the rapid detection of carbapenemase-producing enterobacterales from positive blood cultures: a comparative study. J Hosp Infect. 2020;105(2):162–6.

    Article  CAS  PubMed  Google Scholar 

  37. Hong J, Kang D, Kim D. Performance evaluation of the newly developed in vitro rapid diagnostic test for detecting OXA-48-like, KPC-, NDM-, VIM-and IMP-type carbapenemases: the RESIST-5 OKNVI multiplex lateral flow assay. Antibiotics. 2021;10(4):460.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Wild D. The immunoassay handbook: theory and applications of ligand binding, ELISA and related techniques. Newnes; 2013.

  39. Maharjan M et al. Molecular confirmation of vancomycin-resistant Staphylococcus aureus with vanA gene from a hospital in Kathmandu. International Journal of Microbiology. 2021;2021.

  40. Holmes B, Willcox W, Lapage S. Identification of Enterobacteriaceae by the API 20E system. J Clin Pathol. 1978;31(1):22–30.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Bauer A. Antibiotic susceptibility testing by a standardized single disc method. Am J clin Pathol. 1966;45:149–58.

    Article  Google Scholar 

  42. Wayne P. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing. 29th edition, CLSI supplement M100. 2019.

  43. Wiegand I, Hilpert K, Hancock RE. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 2008;3(2):163–75.

    Article  CAS  PubMed  Google Scholar 

  44. Ain NU, et al. High frequency and molecular epidemiology of metallo-β-lactamase-producing gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan. Volume 7. Antimicrobial Resistance & Infection Control; 2018. p. 128. 1.

  45. Teo J, et al. Molecular characterization of NDM-1 producing Enterobacteriaceae isolates in Singapore hospitals. Western Pac Surveillance Response Journal: WPSAR. 2012;3(1):19.

    Article  PubMed Central  Google Scholar 

  46. Technologies ON. Rapid sequencing gDNA - barcoding (SQK-RBK110.96). 10/03/2023; RBK_9126_v110_revO_24Mar2021:[Available from: https://community.nanoporetech.com/protocols/rapid-barcoding-kit-96-sqk-rbk110-96/checklist_example.pdf

  47. Nucleic Acids Research, Volume 45, Issue D1

  48. Holdgate N, Clair EWSJF. Recent advances in primary Sjogren’s syndrome. 2016;5.

  49. Bathoorn E, et al. Emergence of pan-resistance in KPC-2 carbapenemase-producing Klebsiella pneumoniae in Crete, Greece: a close call. J Antimicrob Chemother. 2016;71(5):1207–12.

    Article  CAS  PubMed  Google Scholar 

  50. Bi W, et al. Extensively drug-resistant Klebsiella pneumoniae causing nosocomial bloodstream infections in China: molecular investigation of antibiotic resistance determinants, informing therapy, and clinical outcomes. Front Microbiol. 2017;8:1230.

    Article  PubMed  PubMed Central  Google Scholar 

  51. Sonnevend Á, et al. Multihospital occurrence of pan-resistant Klebsiella pneumoniae sequence type 147 with an IS Ecp1-directed bla OXA-181 insertion in the mgrB gene in the United Arab Emirates. Antimicrob Agents Chemother. 2017;61(7):00418–17. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/aac

  52. Li J, et al. Colistin: the re-emerging antibiotic for multidrug-resistant Gram-negative bacterial infections. Lancet Infect Dis. 2006;6(9):589–601.

    Article  CAS  PubMed  Google Scholar 

  53. Viehman JA, Nguyen MH, Doi Y. Treatment options for carbapenem-resistant and extensively drug-resistant Acinetobacter baumannii infections. Drugs. 2014;74:1315–33.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Al Mana H, et al. Whole-genome sequencing for molecular characterization of carbapenem-resistant Enterobacteriaceae causing lower urinary tract infection among pediatric patients. Antibiotics. 2021;10(8):972.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. van Duin D, et al. Impact of therapy and strain type on outcomes in urinary tract infections caused by carbapenem-resistant Klebsiella pneumoniae. J Antimicrob Chemother. 2015;70(4):1203–11.

    Article  PubMed  Google Scholar 

  56. Shin S, et al. Emergence of multidrug-resistant Providencia rettgeri isolates co-producing NDM-1 carbapenemase and PER-1 extended-spectrum β-lactamase causing a first outbreak in Korea. Ann Clin Microbiol Antimicrob. 2018;17(1):20.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Dortet L, Poirel L, Nordmann P. Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria. BioMed research international. 2014;2014.

  58. Kumarasamy KK, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10(9):597–602.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Lascols C, et al. Increasing prevalence and dissemination of NDM-1 metallo-β-lactamase in India: data from the SMART study (2009). J Antimicrob Chemother. 2011;66(9):1992–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Boutal H, et al. A multiplex lateral flow immunoassay for the rapid identification of NDM-, KPC-, IMP-and VIM-type and OXA-48-like carbapenemase-producing Enterobacteriaceae. J Antimicrob Chemother. 2018;73(4):909–15.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Mendez-Sotelo BJ, et al. Comparison of lateral Flow Immunochromatography and phenotypic assays to PCR for the detection of carbapenemase-producing gram-negative Bacteria, a Multicenter experience in Mexico. Antibiotics. 2023;12(1):96.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Song W, et al. Rapid identification of OXA-48-like, KPC, NDM, and VIM carbapenemase-producing Enterobacteriaceae from culture: evaluation of the RESIST-4 OKNV multiplex lateral flow assay. Annals Lab Med. 2020;40(3):259.

    Article  CAS  Google Scholar 

  63. Cointe A, et al. Detection of carbapenemase-producing Enterobacteriaceae in positive blood culture using an immunochromatographic RESIST-4 OKNV assay. Antimicrob Agents Chemother. 2018;62(12):01828–18. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/aac

    Article  Google Scholar 

  64. Niu L, et al. Isothermal amplification and rapid detection of Klebsiella pneumoniae based on the multiple cross displacement amplification (MCDA) and gold nanoparticle lateral flow biosensor (LFB). PLoS ONE. 2018;13(10):e0204332.

    Article  PubMed  PubMed Central  Google Scholar 

  65. Hussein NH, et al. Mobilized colistin resistance (mcr) genes from 1 to 10: a comprehensive review. Mol Biol Rep. 2021;48:2897–907.

    Article  CAS  PubMed  Google Scholar 

  66. Carretero-Ledesma M, et al. Phenotypic changes associated with colistin resistance due to lipopolysaccharide loss in Acinetobacter baumannii. Virulence. 2018;9(1):930–42.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  67. Pelletier MR, et al. Unique structural modifications are present in the lipopolysaccharide from colistin-resistant strains of Acinetobacter baumannii. Antimicrob Agents Chemother. 2013;57(10):4831–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  68. Moffatt JH, et al. Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production. Antimicrob Agents Chemother. 2010;54(12):4971–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  69. Olaitan AO, Morand S, Rolain J-M. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria. Front Microbiol. 2014;5:643.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We acknowledge the facilities at The Doctors Laboratory, The Halo Building for providing us the access to the MALDI-TOF equipment.

Funding

This research paper is based on the Ph. D project funded by the Commonwealth Scholarship Commission and Foreign Commonwealth and development office in the UK for author1 under the CSC reference number PKCN-2021-4.

Author information

Authors and Affiliations

  1. Institute of Microbiology and Molecular Genetics, University of the Punjab, Lahore, 54590, Pakistan

    Noor Ul Ain & Saba Riaz

  2. Citilab and Research Center, Lahore, Pakistan

    Saba Riaz

  3. Centre for Clinical Microbiology, University College London, London, UK

    Noor Ul Ain, Linzy Elton, Zahra Sadouki, Timothy D. McHugh & Saba Riaz

Authors
  1. Noor Ul Ain
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Linzy Elton
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Zahra Sadouki
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Timothy D. McHugh
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Saba Riaz
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Noor. Ain: data curation, formal analysis, investigation, methodology, Resources, Software, validation, visualization, and writing of the original draft. S. Riaz and T. McHugh: Study design Review, editing, supervision, validation. L. Elton: WGS methodology, editing. SZ: MALDI and lateral flow analysis.

Corresponding author

Correspondence to Saba Riaz.

Ethics declarations

Ethical approval

The local ethics committee approved the study (CitiLab and Research Centre Ref # 30th − 15 CLRC/ 30th).

Consent to participate

This study does not involve any patients.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ain, N.U., Elton, L., Sadouki, Z. et al. Exploring New Delhi Metallo Beta Lactamases in Klebsiella pneumoniae and Escherichia coli: genotypic vs. phenotypic insights. Ann Clin Microbiol Antimicrob 24, 12 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12941-025-00775-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12941-025-00775-x

Keywords

Annals of Clinical Microbiology and Antimicrobials

ISSN: 1476-0711

Contact us